ID: 1090620609_1090620616

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1090620609 1090620616
Species Human (GRCh38) Human (GRCh38)
Location 11:128557697-128557719 11:128557733-128557755
Sequence CCTGCACCTTCATAAAAACCCCA AACTCTGCTAGAATTTAATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 206} {0: 1, 1: 0, 2: 0, 3: 22, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!