ID: 1090636939_1090636943

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1090636939 1090636943
Species Human (GRCh38) Human (GRCh38)
Location 11:128695096-128695118 11:128695124-128695146
Sequence CCGCCTCCGTTGCAGGGGCCGGC GCCCGCGCCCCGCGCCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97} {0: 2, 1: 2, 2: 22, 3: 129, 4: 696}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!