ID: 1090636941_1090636943

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1090636941 1090636943
Species Human (GRCh38) Human (GRCh38)
Location 11:128695102-128695124 11:128695124-128695146
Sequence CCGTTGCAGGGGCCGGCTGTGAG GCCCGCGCCCCGCGCCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 158} {0: 2, 1: 2, 2: 22, 3: 129, 4: 696}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!