ID: 1090640681_1090640692

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1090640681 1090640692
Species Human (GRCh38) Human (GRCh38)
Location 11:128726547-128726569 11:128726575-128726597
Sequence CCCACCCCCGCCTAAGCTCCATA GGCCTCTGGCCAGAACAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113} {0: 1, 1: 0, 2: 0, 3: 15, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!