ID: 1090640685_1090640696

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1090640685 1090640696
Species Human (GRCh38) Human (GRCh38)
Location 11:128726553-128726575 11:128726604-128726626
Sequence CCCGCCTAAGCTCCATACCAATG GAGTCACTTGGCTAGATAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 99} {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!