ID: 1090642223_1090642230

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1090642223 1090642230
Species Human (GRCh38) Human (GRCh38)
Location 11:128739545-128739567 11:128739563-128739585
Sequence CCCACTACTCTCCATTCCCAAGG CAAGGATTGTTGGCTGAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 297} {0: 1, 1: 0, 2: 2, 3: 9, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!