ID: 1090643570_1090643574

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1090643570 1090643574
Species Human (GRCh38) Human (GRCh38)
Location 11:128749343-128749365 11:128749373-128749395
Sequence CCTTCACTGAAGGCTCGTTCACT CTGGAGGTTGACGCTGTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73} {0: 1, 1: 0, 2: 3, 3: 38, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!