ID: 1090645645_1090645651

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1090645645 1090645651
Species Human (GRCh38) Human (GRCh38)
Location 11:128764909-128764931 11:128764928-128764950
Sequence CCCTAAGGACACCCGCCTGCAGG CAGGTCCTAGTGCAGAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113} {0: 1, 1: 0, 2: 2, 3: 39, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!