ID: 1090678930_1090678937

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1090678930 1090678937
Species Human (GRCh38) Human (GRCh38)
Location 11:129032087-129032109 11:129032114-129032136
Sequence CCTGATTCTTCCTGGACCCCAGA GACTTGGATACAAGTGCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 34, 2: 108, 3: 249, 4: 781} {0: 1, 1: 0, 2: 1, 3: 11, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!