|
Left Crispr |
Right Crispr |
| Crispr ID |
1090685477 |
1090685480 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:129113107-129113129
|
11:129113140-129113162
|
| Sequence |
CCAGCATCACTAGTAGCATTTTG |
GTGGTGTTATTCAAGGTTTATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 6, 2: 59, 3: 116, 4: 277} |
{0: 2, 1: 28, 2: 94, 3: 88, 4: 195} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|