ID: 1090688903_1090688916

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1090688903 1090688916
Species Human (GRCh38) Human (GRCh38)
Location 11:129156572-129156594 11:129156621-129156643
Sequence CCCAGTCAGGGGCTTGTAGATGA CCTGTGAGAAGGTGGGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 25, 2: 532, 3: 666, 4: 555} {0: 1, 1: 1, 2: 11, 3: 97, 4: 1030}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!