ID: 1090711138_1090711143

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1090711138 1090711143
Species Human (GRCh38) Human (GRCh38)
Location 11:129386862-129386884 11:129386901-129386923
Sequence CCTGCCACCACTCCTGTCTGCCT AAATAAACAAATTAAAGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 146, 4: 2465} {0: 1, 1: 0, 2: 7, 3: 125, 4: 1273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!