ID: 1090735520_1090735528

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1090735520 1090735528
Species Human (GRCh38) Human (GRCh38)
Location 11:129609440-129609462 11:129609465-129609487
Sequence CCACGGGGCAAGCCTTCTTGCAT AAACTGGTGGGCAAAAGGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 24, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!