ID: 1090750206_1090750210

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1090750206 1090750210
Species Human (GRCh38) Human (GRCh38)
Location 11:129739986-129740008 11:129740025-129740047
Sequence CCAAAATCCAAGTGTGCAGCTGG AATGTAGCAAATCCACACAATGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 31, 3: 372, 4: 3247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!