ID: 1090752957_1090752960

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1090752957 1090752960
Species Human (GRCh38) Human (GRCh38)
Location 11:129763550-129763572 11:129763564-129763586
Sequence CCAGGGGTCATTGGGGAGGGCTA GGAGGGCTACCAGAGGCACTGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 20, 4: 128} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!