ID: 1090755516_1090755524

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1090755516 1090755524
Species Human (GRCh38) Human (GRCh38)
Location 11:129786540-129786562 11:129786581-129786603
Sequence CCTTGGGCAGCTCCACCCGTGCG TCCCTCCTGGCTGCTTTCACAGG
Strand - +
Off-target summary No data {0: 168, 1: 500, 2: 896, 3: 1064, 4: 1267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!