ID: 1090769390_1090769395

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1090769390 1090769395
Species Human (GRCh38) Human (GRCh38)
Location 11:129906447-129906469 11:129906490-129906512
Sequence CCAGGCGTTGAAATCCAGGGGTC CACACACAACCCTATCACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 119} {0: 1, 1: 0, 2: 1, 3: 26, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!