ID: 1090780240_1090780248

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1090780240 1090780248
Species Human (GRCh38) Human (GRCh38)
Location 11:130001802-130001824 11:130001823-130001845
Sequence CCGACCGGCCTCGCCCTGCCTCT CTGCGCTGCACCCTGGGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 359} {0: 1, 1: 0, 2: 5, 3: 182, 4: 3009}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!