ID: 1090780370_1090780385

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1090780370 1090780385
Species Human (GRCh38) Human (GRCh38)
Location 11:130002157-130002179 11:130002208-130002230
Sequence CCCCGGTGCTCGGCTCCCGGCCG GCCCGCGCAACCGCCGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156} {0: 1, 1: 1, 2: 0, 3: 34, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!