ID: 1090780380_1090780393

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1090780380 1090780393
Species Human (GRCh38) Human (GRCh38)
Location 11:130002191-130002213 11:130002238-130002260
Sequence CCCGCCGCGCCCGGAGCGCCCGC AGGCCGCCCAACCGCCGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 12, 3: 55, 4: 468} {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!