ID: 1090780387_1090780400

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1090780387 1090780400
Species Human (GRCh38) Human (GRCh38)
Location 11:130002210-130002232 11:130002253-130002275
Sequence CCGCGCAACCGCCGCCGCCGGAG CGTCCCGGCCCAACCAACGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 457} {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!