ID: 1090780392_1090780400

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1090780392 1090780400
Species Human (GRCh38) Human (GRCh38)
Location 11:130002227-130002249 11:130002253-130002275
Sequence CCGGAGCGCGCAGGCCGCCCAAC CGTCCCGGCCCAACCAACGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57} {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!