ID: 1090795157_1090795160

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1090795157 1090795160
Species Human (GRCh38) Human (GRCh38)
Location 11:130129088-130129110 11:130129110-130129132
Sequence CCAGTGAGAAGCAGCAGCTGGTG GGAGACCCACCTGGCCCGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 369} {0: 1, 1: 0, 2: 1, 3: 14, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!