ID: 1090805500_1090805517

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1090805500 1090805517
Species Human (GRCh38) Human (GRCh38)
Location 11:130199684-130199706 11:130199733-130199755
Sequence CCCTCGCTGCATTTGTGAGGGAG ATTTGGGAGCGGGGAGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 254} {0: 1, 1: 0, 2: 3, 3: 37, 4: 513}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!