ID: 1090831419_1090831425

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1090831419 1090831425
Species Human (GRCh38) Human (GRCh38)
Location 11:130423376-130423398 11:130423412-130423434
Sequence CCTGGTAGCCACAGAGCAGGGGG TTTCTGTTGTCATCCAAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 313} {0: 1, 1: 0, 2: 0, 3: 11, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!