ID: 1090863383_1090863387

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1090863383 1090863387
Species Human (GRCh38) Human (GRCh38)
Location 11:130673815-130673837 11:130673836-130673858
Sequence CCTGTTTCCATGCTCTAGTCCAA AAGGCCTGCTCTCCTTCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 159} {0: 1, 1: 0, 2: 1, 3: 39, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!