ID: 1090882923_1090882931 |
View in Genome Browser |
Spacer: 13 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1090882923 | 1090882931 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 11:130850041-130850063 | 11:130850077-130850099 |
Sequence | CCCCCACAAATTCATGTGTTGAA | ATGTGGCTATGTTTGGAGATAGG |
Strand | - | + |
Off-target summary | {0: 3, 1: 40, 2: 326, 3: 1321, 4: 2768} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |