|
Left Crispr |
Right Crispr |
| Crispr ID |
1090910965 |
1090910973 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:131118934-131118956
|
11:131118968-131118990
|
| Sequence |
CCTTCCACCTTGCCCTCTCAAAG |
CAGGCCTGAGCCCCCGCACCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 90, 2: 2665, 3: 30748, 4: 88334} |
{0: 5, 1: 334, 2: 15169, 3: 79077, 4: 135447} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|