ID: 1090910965_1090910975

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1090910965 1090910975
Species Human (GRCh38) Human (GRCh38)
Location 11:131118934-131118956 11:131118975-131118997
Sequence CCTTCCACCTTGCCCTCTCAAAG GAGCCCCCGCACCTGGCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 90, 2: 2665, 3: 30748, 4: 88334} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!