ID: 1090943467_1090943473

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1090943467 1090943473
Species Human (GRCh38) Human (GRCh38)
Location 11:131409337-131409359 11:131409366-131409388
Sequence CCATCTGGGCTACAAAGAGGTGT GAGGAAACCTGGAGAAGCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 113} {0: 1, 1: 1, 2: 1, 3: 29, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!