ID: 1090947508_1090947514

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1090947508 1090947514
Species Human (GRCh38) Human (GRCh38)
Location 11:131444658-131444680 11:131444685-131444707
Sequence CCTTAAGAAGTGTGGTTGTGGGG TGGCACAGAACATTTAGGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 119} {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!