ID: 1090956662_1090956665

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1090956662 1090956665
Species Human (GRCh38) Human (GRCh38)
Location 11:131519138-131519160 11:131519159-131519181
Sequence CCACTTCATGAGGAGAAGCCCTG TGAGTTTCAAATTGAGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 185} {0: 1, 1: 1, 2: 0, 3: 10, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!