ID: 1090966413_1090966422

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1090966413 1090966422
Species Human (GRCh38) Human (GRCh38)
Location 11:131601159-131601181 11:131601209-131601231
Sequence CCTCAACCTCTGATTTGGCTTGG GGGAGCATACAGATGGACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 223} {0: 1, 1: 2, 2: 4, 3: 17, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!