ID: 1090972208_1090972214

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1090972208 1090972214
Species Human (GRCh38) Human (GRCh38)
Location 11:131653553-131653575 11:131653594-131653616
Sequence CCCTGCCACAGTGGCTGAGTGGA CAAACTGTGAGATGTTTAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 197} {0: 1, 1: 0, 2: 2, 3: 12, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!