ID: 1090972555_1090972558

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1090972555 1090972558
Species Human (GRCh38) Human (GRCh38)
Location 11:131655778-131655800 11:131655823-131655845
Sequence CCAAGCTCTGTGTGAGGCAATGA AGAGAAATTCTAGTCTCCACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 28, 4: 759} {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!