ID: 1090976229_1090976235

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1090976229 1090976235
Species Human (GRCh38) Human (GRCh38)
Location 11:131682860-131682882 11:131682892-131682914
Sequence CCTGGGAAGCATGTTGCGCCCAC GCACATTTTACCTACCAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 91} {0: 1, 1: 0, 2: 1, 3: 7, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!