ID: 1090976229_1090976235 |
View in Genome Browser |
Spacer: 9 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1090976229 | 1090976235 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 11:131682860-131682882 | 11:131682892-131682914 |
Sequence | CCTGGGAAGCATGTTGCGCCCAC | GCACATTTTACCTACCAGCCGGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 0, 2: 1, 3: 5, 4: 91} | {0: 1, 1: 0, 2: 1, 3: 7, 4: 87} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |