ID: 1090979202_1090979209

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1090979202 1090979209
Species Human (GRCh38) Human (GRCh38)
Location 11:131702158-131702180 11:131702186-131702208
Sequence CCTGACCCACATCTTCCATCTCA ACCAGGGATCGGCCCACACTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 318} {0: 1, 1: 0, 2: 0, 3: 1, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!