ID: 1090984632_1090984645

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1090984632 1090984645
Species Human (GRCh38) Human (GRCh38)
Location 11:131755305-131755327 11:131755336-131755358
Sequence CCTAGCAGGAATCCCAATGACCC AAGACTGGCAAGGGAGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 194} {0: 1, 1: 1, 2: 3, 3: 32, 4: 412}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!