ID: 1090999259_1090999269

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1090999259 1090999269
Species Human (GRCh38) Human (GRCh38)
Location 11:131894676-131894698 11:131894714-131894736
Sequence CCAGATTGCAAACCACCAGCAGC CTATCAAACCAGAGCAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 113} {0: 1, 1: 0, 2: 1, 3: 11, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!