ID: 1091002073_1091002075

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1091002073 1091002075
Species Human (GRCh38) Human (GRCh38)
Location 11:131918107-131918129 11:131918135-131918157
Sequence CCTGGTTTTACAGATAGTGGAAG ATAATCAGTCTTGCGTAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 200} {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!