ID: 1091002239_1091002242

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1091002239 1091002242
Species Human (GRCh38) Human (GRCh38)
Location 11:131919382-131919404 11:131919421-131919443
Sequence CCAAGGACTTATTGGGTTTAGGA ATGTGTGAGCTGAAGGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93} {0: 1, 1: 0, 2: 4, 3: 40, 4: 496}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!