ID: 1091003676_1091003684

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1091003676 1091003684
Species Human (GRCh38) Human (GRCh38)
Location 11:131932739-131932761 11:131932775-131932797
Sequence CCCACAGGGGACTTTCCAGATGC CTGAGCTGCAGGAGGTACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 275} {0: 1, 1: 0, 2: 2, 3: 27, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!