ID: 1091009376_1091009381

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1091009376 1091009381
Species Human (GRCh38) Human (GRCh38)
Location 11:131984551-131984573 11:131984571-131984593
Sequence CCACATCTGAAGTGGTCATTGTG GTGGAGTACGCCCTACTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 121} {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!