ID: 1091009693_1091009697

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1091009693 1091009697
Species Human (GRCh38) Human (GRCh38)
Location 11:131988041-131988063 11:131988075-131988097
Sequence CCAATATCAAGGCACCATCCGAT TGAGAGTCCATTTCCTCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 249, 4: 784} {0: 1, 1: 0, 2: 1, 3: 12, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!