ID: 1091020150_1091020154

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1091020150 1091020154
Species Human (GRCh38) Human (GRCh38)
Location 11:132092314-132092336 11:132092339-132092361
Sequence CCTTCCTCAGAGTGCCTGGCCTC TCCTGCCACTCCACTGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 42, 4: 331} {0: 1, 1: 0, 2: 0, 3: 24, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!