ID: 1091024505_1091024510

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1091024505 1091024510
Species Human (GRCh38) Human (GRCh38)
Location 11:132130067-132130089 11:132130113-132130135
Sequence CCAGAGTCTGTTAGGACTTTGGG AAATATTCTCAGAAGGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 147} {0: 1, 1: 1, 2: 3, 3: 60, 4: 554}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!