ID: 1091026867_1091026873

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1091026867 1091026873
Species Human (GRCh38) Human (GRCh38)
Location 11:132149296-132149318 11:132149339-132149361
Sequence CCCTAATTCCCCTAGCAGAAGCT GCTATTCAGCCCTGAGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 119} {0: 1, 1: 0, 2: 0, 3: 9, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!