ID: 1091033730_1091033735

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1091033730 1091033735
Species Human (GRCh38) Human (GRCh38)
Location 11:132214478-132214500 11:132214516-132214538
Sequence CCTGCCATTTTATGCCTATAACT TTTGTTGTTGTTCTATGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 389} {0: 1, 1: 0, 2: 10, 3: 71, 4: 584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!