ID: 1091037661_1091037666

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1091037661 1091037666
Species Human (GRCh38) Human (GRCh38)
Location 11:132248008-132248030 11:132248032-132248054
Sequence CCATTAAATGGTCACAGCCCACA CATCCAAACATGGGAGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 123} {0: 1, 1: 0, 2: 1, 3: 39, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!