ID: 1091041725_1091041730

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1091041725 1091041730
Species Human (GRCh38) Human (GRCh38)
Location 11:132287152-132287174 11:132287171-132287193
Sequence CCAGTCCTTAGGCCCTTTAGGCA GGCAAGGCCAGTTTCAGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80} {0: 1, 1: 0, 2: 1, 3: 16, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!